Array 1 256-44 **** Predicted by CRISPRDetect 2.4 *** >NZ_UKSE01000283.1 Klebsiella pneumoniae strain EuSCAPE_IT214, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================= ================================ ================== 255 29 100.0 32 ............................. CAGGTTAAACATGTAAAAAATGACCGTCGCCG 194 29 100.0 32 ............................. CACATTGCCCGGTCTGAAAAGTATTTGAAAAT 133 29 100.0 32 ............................. TCCGCACAGTCAAACGCTCCAGACACCAACCC 72 29 100.0 0 ............................. | ========== ====== ====== ====== ============================= ================================ ================== 4 29 100.0 32 GTGTTCCCCGCGCCAGCGGGGATAAACCG # Left flank : TTG # Right flank : GCCGGAACACCACCAGTAACAGCTACTGTAGGCGTGTTCCCCGC # Questionable array : NO Score: 5.86 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTGTTCCCCGCGCCAGCGGGGATAAACCG # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [4,5] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTGTTCCCCGCGCCAGCGGGGATAAACCG with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-12.00,-13.50] Score: 0.37/0.37 # Array degeneracy analysis prediction: R [1-0] Score: 0.41/0.41 # AT richness analysis in flanks prediction: F [28.3-5.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.27,5.65 Confidence: HIGH] # Array family : I-E [Matched known repeat from this family], // Array 1 415-20 **** Predicted by CRISPRDetect 2.4 *** >NZ_UKSE01000159.1 Klebsiella pneumoniae strain EuSCAPE_IT214, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================= ================================ ================== 414 29 100.0 32 ............................. GGGCTGCCGCACGCCTGGGACGAGTCGAGCCC 353 29 100.0 32 ............................. CCGCAATAACAAAAATAAATGAGGGTTAAAGT 292 29 100.0 32 ............................. GTAAATGGGAATGAGTAGAAGAGCGTCATTGG 231 29 100.0 32 ............................. ATTAAATTTTTCGGGTAAAGAGAAATTGCGAA 170 29 100.0 32 ............................. CTGCGAGCTACCCTGAATTTCAGCGACAGGGG 109 29 100.0 32 ............................. TAGTGCCATATATTATCCTCTGCGGTATGACT 48 29 100.0 0 ............................. | ========== ====== ====== ====== ============================= ================================ ================== 7 29 100.0 32 GTGTTCCCCGCGCCAGCGGGGATAAACCG # Left flank : GACGAGTCGAGCC # Right flank : GGAGACTATTATGCGAAAAA # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTGTTCCCCGCGCCAGCGGGGATAAACCG # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [4,5] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTGTTCCCCGCGCCAGCGGGGATAAACCG with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-12.00,-13.50] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [21.7-6.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.27,5.24 Confidence: HIGH] # Array family : I-E [Matched known repeat from this family], // Array 1 419-24 **** Predicted by CRISPRDetect 2.4 *** >NZ_UKSE01000160.1 Klebsiella pneumoniae strain EuSCAPE_IT214, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================= ================================ ================== 418 29 100.0 32 ............................. CTGCAGGTAAATGACTGGATGGGGGAAGAGGT 357 29 100.0 32 ............................. CACGTCCGGAAACCACGGGTTATCCGTGTAAT 296 29 100.0 32 ............................. CAGAGGTCCTTATCTTTTCAACGTCAAAGTCG 235 29 100.0 32 ............................. GCAATCCCAGAGCGCGAATATCTTGGGCTCTC 174 29 100.0 32 ............................. GTGATCGTCATGGATATCACTGCCGTTCCGTC 113 29 100.0 32 ............................. CAGACAGACAGCAGGCAGCAAACAGGGAAGAC 52 29 100.0 0 ............................. | ========== ====== ====== ====== ============================= ================================ ================== 7 29 100.0 32 GTGTTCCCCGCGCCAGCGGGGATAAACCG # Left flank : CGCCA # Right flank : GGGGTTCACTTGGGTGAAACTGAA # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTGTTCCCCGCGCCAGCGGGGATAAACCG # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [4,5] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTGTTCCCCGCGCCAGCGGGGATAAACCG with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-12.00,-13.50] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [20.0-1.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.27,5.24 Confidence: HIGH] # Array family : I-E [Matched known repeat from this family], // Array 1 221-9 **** Predicted by CRISPRDetect 2.4 *** >NZ_UKSE01000290.1 Klebsiella pneumoniae strain EuSCAPE_IT214, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================= ================================ ================== 220 29 100.0 32 ............................. GTTGTCAGTCAGGGAAAATCTATCCGCAGGGG 159 29 96.6 32 .G........................... TGATTGTCGCTATACCAGCGCTCAAGGAAAAT 98 29 100.0 32 ............................. GTCAGATCACGTCAACCACGCTTGATTTTACC 37 29 100.0 0 ............................. | ========== ====== ====== ====== ============================= ================================ ================== 4 29 99.2 32 GTGTTCCCCGCGCCAGCGGGGATAAACCG # Left flank : GCGATCAACGTACCGGGACTACTCTGCAGACC # Right flank : GCTCACTAA # Questionable array : NO Score: 5.82 # Score Detail : 1:0, 2:3, 3:0, 4:0.96, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTGTTCCCCGCGCCAGCGGGGATAAACCG # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [3,5] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTGTTCCCCGCGCCAGCGGGGATAAACCG with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-5.60,-7.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [8.3-25.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,5.51 Confidence: HIGH] # Array family : I-E [Matched known repeat from this family], //