Array 1 249-80 **** Predicted by CRISPRDetect 2.4 *** >NZ_CABGNY010000200.1 Klebsiella grimontii strain 4928STDY7071433, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ===================================== ============================= ================== 248 37 97.3 29 ....................................A GAAAACTATACTCATATTTTTAAAGGTGT 182 37 97.3 29 ....................................G ATAACTTAGAAAAGATGCAGGATGTTTTT 116 37 100.0 0 ..................................... | ========== ====== ====== ====== ===================================== ============================= ================== 3 37 98.2 30 GTTTTGGTACCATTCTAAACAACATGACTCTAAAACC # Left flank : | # Right flank : CTCGGAGAATTATTTTTTTCCAAAGTTCCGTACTCGCATCACTTATCCATAGCTAGATTTCAGTTTAGAATGAACCACTA # Questionable array : NO Score: 5.58 # Score Detail : 1:0, 2:3, 3:0, 4:0.91, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTGGTACCATTCTAAACAACATGACTCTAAAACC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:67.57%AT] # Reference repeat match prediction: R [matched GTTTTGGTACCATTCTAAACAACATGACTCTAAAACT with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: NA [0.00,0.00] Score: 0/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: F [63.3-0.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.68,4.5 Confidence: HIGH] # Array family : II-C [Matched known repeat from this family], // Array 1 10-640 **** Predicted by CRISPRDetect 2.4 *** >NZ_CABGNY010000158.1 Klebsiella grimontii strain 4928STDY7071433, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ===================================== ============================= ================== 10 37 97.3 29 ....................................A CACCTTTAAAAATATGAGTATAGTTTTCT 76 37 100.0 29 ..................................... GGCTTGTTGTTACGTGTATTACAGACGGG 142 37 97.3 29 ....................................G CACACACACGCTACTCACAGGCATTATAG 208 37 97.3 29 ....................................G CGAGAAAAAACGTATGGTGGAAATTGTTG 274 37 100.0 29 ..................................... AAAGCAGCTTCTAAAACAGAAGGTGAAAT 340 37 97.3 29 ....................................G ATTGGTAAGATTACATGACCTTTAGTACG 406 37 97.3 29 ....................................A AAGAAATGGACACATTACACAACGCTTTC 472 37 100.0 29 ..................................... GGGGCTAAAGGTGTAGCACATCAAGTTTC 538 37 100.0 29 ..................................... CATAGCAGACCAACCTGCTCCATCGCTTG 604 37 97.3 0 ....................................C | ========== ====== ====== ====== ===================================== ============================= ================== 10 37 98.4 29 GTTTTAGAGTCATGTTGTTTAGAATGGTACCAAAACT # Left flank : TAAGTTATCG # Right flank : AATGTAAATGCTCATTATGATTTACATATGTTTTAGAGTCATGTTGTTTAGTTTTCGCAGATACGATTTGATT # Questionable array : NO Score: 5.87 # Score Detail : 1:0, 2:3, 3:0, 4:0.92, 5:0, 6:0.25, 7:0.01, 8:1, 9:0.69, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGTCATGTTGTTTAGAATGGTACCAAAACT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:66.67%AT] # Reference repeat match prediction: F [matched GTTTTAGAGTCATGTTGTTTAGAATGGTACCAAAACT with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: NA [0.00,0.00] Score: 0/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [11.7-71.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.5,0.27 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 177-8 **** Predicted by CRISPRDetect 2.4 *** >NZ_CABGNY010000225.1 Klebsiella grimontii strain 4928STDY7071433, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ===================================== ============================= ================== 176 37 97.3 29 ....................................G TTTTCATTTAAGTAGTGCGCTTGATATGC 110 37 100.0 29 ..................................... CATAGCAGACCAACCTGCTCCATCGCTTG 44 37 97.3 0 ....................................C | ========== ====== ====== ====== ===================================== ============================= ================== 3 37 98.2 30 GTTTTAGAGTCATGTTGTTTAGAATGGTACCAAAACT # Left flank : GCATTATA # Right flank : CAATGTAA # Questionable array : NO Score: 5.58 # Score Detail : 1:0, 2:3, 3:0, 4:0.91, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGTCATGTTGTTTAGAATGGTACCAAAACT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:66.67%AT] # Reference repeat match prediction: R [matched GTTTTAGAGTCATGTTGTTTAGAATGGTACCAAAACT with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: NA [0.00,0.00] Score: 0/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [10.0-10.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,4.5 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 178-9 **** Predicted by CRISPRDetect 2.4 *** >NZ_CABGNY010000224.1 Klebsiella grimontii strain 4928STDY7071433, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ===================================== ============================= ================== 177 37 97.3 29 ....................................A CACCTTTAAAAATATGAGTATAGTTTTCT 111 37 100.0 29 ..................................... TTTTCATTTAAGTAGTGCGCTTGATATGC 45 37 100.0 0 ..................................... | ========== ====== ====== ====== ===================================== ============================= ================== 3 37 99.1 30 GTTTTAGAGTCATGTTGTTTAGAATGGTACCAAAACG # Left flank : TAAGTTAT # Right flank : GCGAGAAAA # Questionable array : NO Score: 5.31 # Score Detail : 1:0, 2:3, 3:0, 4:0.95, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:0.69, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGTCATGTTGTTTAGAATGGTACCAAAACG # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:66.67%AT] # Reference repeat match prediction: R [matched GTTTTAGAGTCATGTTGTTTAGAATGGTACCAAAACT with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: NA [0.00,0.00] Score: 0/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [8.3-11.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,4.5 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 1-169 **** Predicted by CRISPRDetect 2.4 *** >NZ_CABGNY010000229.1 Klebsiella grimontii strain 4928STDY7071433, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ===================================== ============================= ================== 1 37 100.0 29 ..................................... TTTTCATTTAAGTAGTGCGCTTGATATGC 67 37 100.0 29 ..................................... CGAGAAAAAACGTATGGTGGAAATTGTTG 133 37 97.3 0 ....................................T | ========== ====== ====== ====== ===================================== ============================= ================== 3 37 99.1 30 GTTTTAGAGTCATGTTGTTTAGAATGGTACCAAAACG # Left flank : | # Right flank : AAAGCAGC # Questionable array : NO Score: 5.31 # Score Detail : 1:0, 2:3, 3:0, 4:0.95, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:0.69, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGTCATGTTGTTTAGAATGGTACCAAAACG # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:64.86%AT] # Reference repeat match prediction: F [matched GTTTTAGAGTCATGTTGTTTAGAATGGTACCAAAACT with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: NA [0.00,0.00] Score: 0/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: NA [0.0-6.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.91,0 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 9-176 **** Predicted by CRISPRDetect 2.4 *** >NZ_CABGNY010000230.1 Klebsiella grimontii strain 4928STDY7071433, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ===================================== ============================= ================== 9 37 100.0 29 ..................................... CACACACACGCTACTCACAGGCATTATAG 75 37 100.0 29 ..................................... TTTTCATTTAAGTAGTGCGCTTGATATGC 141 36 97.3 0 ....................................- | ========== ====== ====== ====== ===================================== ============================= ================== 3 37 99.1 30 GTTTTAGAGTCATGTTGTTTAGAATGGTACCAAAACG # Left flank : CAGACGGGG # Right flank : | # Questionable array : NO Score: 5.31 # Score Detail : 1:0, 2:3, 3:0, 4:0.95, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:0.69, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGTCATGTTGTTTAGAATGGTACCAAAACG # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:64.86%AT] # Reference repeat match prediction: F [matched GTTTTAGAGTCATGTTGTTTAGAATGGTACCAAAACT with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: NA [0.00,0.00] Score: 0/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: NA [3.3-0.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.91,0 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 4536-4992 **** Predicted by CRISPRDetect 2.4 *** >NZ_CABGNY010000070.1 Klebsiella grimontii strain 4928STDY7071433, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================= ================================= ================== 4536 29 100.0 32 ............................. AAACATTTTGAAAATCAAATACATATAATATA 4597 29 100.0 32 ............................. AGTATAATCGTGAGCGATTTGCTTATACAGAG 4658 29 100.0 32 ............................. TTACGCGGTGGCTTCGCTCGTAGCCTGCCGTT 4719 29 100.0 32 ............................. GCCATCAATAATGTTTAAATTTTCCGGGCAAA 4780 29 100.0 32 ............................. GTTGAGATTGATGTGGGGCTGGACGGTAAAAT 4841 29 100.0 33 ............................. GCGTCAATCATCAGCGTTTTAACGTCTGCTAGC 4903 29 100.0 33 ............................. GCGGTGAACTCAGTTGCAAGTGGGCAGGGTGAG 4964 29 93.1 0 .............T..............A | ========== ====== ====== ====== ============================= ================================= ================== 8 29 99.1 32 GTGTTCCCCGCGCCAGCGGGGATAAACCG # Left flank : CGCGATATCGCGGTGTTCTCAAAGGGCAATATTCAGCGCCTGGTCGGCGCGCTGGCGGAGAGCCATCGCCTCACGCTGCATACGCGTTATCAGGTTGACTATATTGAAACGCTTTACGGCCTGGTGCGTTCCCGGCTGGCGGTGGCGATTCTGCCTGAGCTTTATACCACTCACCTTCAGGATCCGGCGTTAAAGGTGGCGCAACTTCAGCAGCCGGCGCTGACGCGAACCGTGGCGCTGATGCGCGGGCCGCAGCCTCTGCCGCCGCTGATAGAAGCGTGTTTTACATTATTACTGAGTTCGCTGCGGGAAGTGAATCTGTAGAGGCCGTTGCTCTCTCAGCTTGTTGTGGTGAAATGTGAGAGAGGTAACGGAATAGTTTCTTGTGCCTTTTAAAATCAAATAGTTATGGCTCTTTAAAAAAATCAATTTGTTGCAAAAATGTTGGTAGATTGTTCTTGGCGGATAAATTTATTATAAAACAATAAGATATGGTTAGT # Right flank : ACAGTCAATGTTTCCCGAACATGGTTCTAAAGAGTGTTCCCCCGCAGCTGGCCGCCGCGGGGGCTGATTTACGGCGTCACGATATTGAACCAGAACTCAAATTTATCCATATAGCCCAGCATCTCATCCAGCTTCGCGCCATCGCCGGTCACTTTCACTTCACCCTTATCCTGCGCCTGTTTTAGCGTTTCCTCTTTCAGGATGATTTTGTTCAGCGTGGCGCGATCCAACGCAATGGTAGCATCCGCGTCCTTGGCTTCGGCATCGGCGGTGTGGTTGAGCACGCCGTTTTCCAGCTCCAGCTTATATTTACCGCCATCGTTACCCAGGTCGATATTGAACACCGCTTTGGCGGTTCCGGCTTTCTCACCATTAATATACACCGCAAGGTAATCGAAGAACATTTCCGGGGTCATCGCCCGTACGGTATCCGGGCTGGCGGTGTTCGGCGTCGGGCCTTTCACTACGCCGTTGCGTAGCTCCTGAGCGCCGGTCAGGTA # Questionable array : NO Score: 6.21 # Score Detail : 1:0, 2:3, 3:0, 4:0.95, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTGTTCCCCGCGCCAGCGGGGATAAACCG # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: F [5,4] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTGTTCCCCGCGCCAGCGGGGATAAACCG with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-13.50,-12.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-2] Score: 0.41/0.41 # AT richness analysis in flanks prediction: F [73.3-40.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.92,0 Confidence: HIGH] # Array family : I-E [Matched known repeat from this family], //