Array 1 6-400 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_ULAB01000115.1 Klebsiella pneumoniae strain EuSCAPE_ES066, whole genome shotgun sequence		Array_Orientation: Forward

  Position	Repeat	   %id	Spacer	Repeat_Sequence              	Spacer_Sequence                 	Insertion/Deletion
==========	======	======	======	=============================	================================	==================
         6	    29	 100.0	    32	.............................	GGCGATGCGCGCTCTGCTGGCTATCGGTAAAA	
        67	    29	 100.0	    32	.............................	AATGCAGCAACCGGCAAATATATCGCCGGTAA	
       128	    29	 100.0	    32	.............................	GGGCTGCCGCACGCCTGGGACGAGTCGAGCCC	
       189	    29	 100.0	    32	.............................	CCGCAATAACAAAAATAAATGAGGGTTAAAGT	
       250	    29	 100.0	    32	.............................	GTAAATGGGAATGAGTAGAAGAGCGTCATTGG	
       311	    29	 100.0	    32	.............................	CCCCCGCGCACATGCTTAAACGCGCTATCACG	
       372	    29	 100.0	     0	.............................	|                               	
==========	======	======	======	=============================	================================	==================
         7	    29	 100.0	    32	GTGTTCCCCGCGCCAGCGGGGATAAACCG	                                	       

# Left flank :   ATTCAG
# Right flank :  GGCATCTGTTGTGTAATGTTG

# Questionable array : NO	 Score: 6.26
# 	Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     GTGTTCCCCGCGCCAGCGGGGATAAACCG
# Alternate repeat :   NA

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         NA Score: 0/4.5
# 	A,T distribution in repeat prediction:     F [5,4] Score: 0.37/0.37
# 	Reference repeat match prediction:         F [matched GTGTTCCCCGCGCCAGCGGGGATAAACCG with 100% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  F [-13.50,-12.00] Score: 0.37/0.37
# 	Array degeneracy analysis prediction:      NA [0-0] Score: 0/0.41
# 	AT richness analysis in flanks prediction: R [6.7-20.0]%AT Score: 0.27/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         F [5.24,0.27   Confidence: HIGH] 

# Array family : I-E [Matched known repeat from this family],   
//


Array 1 35-302 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_ULAB01000198.1 Klebsiella pneumoniae strain EuSCAPE_ES066, whole genome shotgun sequence		Array_Orientation: Forward

  Position	Repeat	   %id	Spacer	Repeat_Sequence              	Spacer_Sequence                 	Insertion/Deletion
==========	======	======	======	=============================	================================	==================
        35	    29	 100.0	    32	.............................	GACATGGCGCGCGAGTTTATCGACGCCTGCGC	
        96	    29	 100.0	    32	.............................	GGGATGAGCGTTTTCCGGTGGATTCTGATGTG	
       157	    29	 100.0	    32	.............................	GTGATCGTCATGGATATCACTGCCGTTCCGTC	
       218	    29	 100.0	    32	.............................	CAGACAGACAGCAGGCAGCAAACAGGGAAGAC	
       279	    24	  82.8	     0	........................-----	|                               	
==========	======	======	======	=============================	================================	==================
         5	    29	  96.6	    32	GTGTTCCCCGCGCCAGCGGGGATAAACCG	                                	       

# Left flank :   CGCACATTGCCCGGTCTGAAAAGTATTTGAAAATG
# Right flank :  |

# Questionable array : NO	 Score: 5.89
# 	Score Detail : 1:0, 2:3, 3:0, 4:0.83, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     GTGTTCCCCGCGCCAGCGGGGATAAACCG
# Alternate repeat :   NA

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         NA Score: 0/4.5
# 	A,T distribution in repeat prediction:     R [3,4] Score: 0.37/0.37
# 	Reference repeat match prediction:         F [matched GTGTTCCCCGCGCCAGCGGGGATAAACCG with 100% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  NA [-6.50,-6.30] Score: 0/0.37
# 	Array degeneracy analysis prediction:      NA [0-0] Score: 0/0.41
# 	AT richness analysis in flanks prediction: F [33.3-0.0]%AT Score: 0.27/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         F [4.77,0.37   Confidence: HIGH] 

# Array family : I-E [Matched known repeat from this family],   
//